瀚海新酶

mRNA Vaccine and Drug Proof-of-Concept Services

mRNA vaccines and drugs

The mRNA vaccine broke the traditional immune activation mode of inactivated and attenuated vaccines, and innovatively used human cells to produce antigens to activate specific immunity, which was brilliant during the COVID-19 epidemic. The application prospects of mRNA vaccines and drugs are very broad. In addition to being used for preventing infectious diseases, treating tumors and immune diseases, they can also be applied in various biopharmaceutical platform technologies, such as protein supplementation therapy, cell therapy, antibody drugs, gene editing, and so on. In the post COVID-19 era, mRNA vaccines still have the potential for substantial growth.

Preparation of mRNA immune antigen antibody

mRNA has the potential to encode almost all proteins. MRNA vaccine technology can be applied to antigen preparation to solve the difficulties in protein preparation, such as long preparation cycles, complex production processes, and poor flexibility in customized production of traditional protein antigens. MRNA, as a platform technology, has the advantages of simple production process, short production cycle, and high flexibility. It can provide customers with antigen preparation faster and more cost effectively, and conduct rapid target feasibility verification.

Production Cycle

Production Process

Expression System

Flexibility in customized production

Supporting Infrastructure

Infectious Risk

Difficulty or Facility of Production

Production Costs

Protein Antigen

mRNA Antigen

Long

Short

Complex, low referenceability of processes between different proteins

Relatively simple, with high process reference between different mRNA sequences

Multiple expression systems are needed according to the requirements, and the subsequent process is complex

The expression system is simple, with complete post-translational modification functions and the most perfect physiological environment

Due to the complexity of the process and poor flexibility

Based on different sequence processes, it has high reference value and flexibility

Multiple and complex facilities

Less and simpler

Expressing the risk of infection in the host

No risk of infection

Difficulties and complex production processes

Easy, can be produced on a platform

Tall

Low

Hanhai New Enzyme provides one-stop mRNA vaccine&drug development concept validation services to help customers quickly verify the feasibility of drug targets

- Experienced team has successfully delivered multiple concept validation projects

- Diversified tools are used to predict the secondary structure of proteins using alphafold, providing guidance for customers' antigen design and mRNA sequence design.

- Our independently established mRNA technology and application platform, comprehensive quality system, and full process services from sequence design, mRNA LNP preparation to in vivo biological evaluation.

01

Submit Requirements

02

Sale Confirmation

03

Sequence Design

04

Gene synthesis and plasmid amplification

05

IVT synthesis of mRNA

06

Cell translation level detection

07

08

LNP Encapsulation

Animal in vivo validation

DELIVERY STANDARDS

Service category	Duration (working days)	Deliver
Sequence design	5	10 candidate sequences
Plasmid construction and amplification	30	Plasmids and sequence files, providing synthesized raw plasmids (1-2 μ g)
mRNA raw material synthesis	5	mRNA Raw Liquid Detection Report
mRNA cell translation level detection	10	Translation Proficiency Test Report
LNP encapsulation	10	1mg LNP
In vivo translation level detection (optional)	20	Test report
In vivo cellular immune testing (optional)	10	Test report
Fluid immune testing (optional)	20	Test report
In vivo translation level+humoral immune testing (optional)	20	Test report
In vivo translation level+humoral immune detection+cellular immune detection (optional)	20	Test report

CASE

mRNA vaccine design

01.

Sequence design

02.

Plasmid prep

03.

In vitro transcription synthesis of mRNA

04.

Translation proficiency testing

05.

LNP encapsulation

step1： Confirm amino acid sequence

Based on the AI intelligent tool - Alphafold protein structure prediction and analysis tool, and in cooperation with the State Key Laboratory of Microbiology of Shanghai Jiaotong University, a protein structure prediction and optimization system was built

step2： Decoding DNA nucleotide sequences

Hanhai New Enzyme utilizes various sequence optimization tools to output nucleotide sequence files, providing support for the next optimization step

01

·Target determination: Identify the targets for drug development.

02

·Optimization design: Based on MFE and CAI multi parameter combination, output multiple candidate sequences and sort them.

03

·Screening scheme: Based on the MFE and CAI of the selected sequence, with the standard of covering all sequence sets as comprehensively as possible, select candidate sequences and use them for wet experiments

04

·Experimental verification: Through wet experiments, select the best sequence.

05

·Delivery of optimal sequence: The sequence delivered to the customer will be rigorously screened and most likely to become the optimal candidate for drug phenology.

Step 3: mRNA sequence optimization

① Kozak sequence significantly increases protein expression

— Kozak

+ Kozak

③ Transcription initiation sequence

	T7 promoter+transcription start sequence	IVT production
saRNA-EGFP（AU,UTP）	TAATACGACTCACTATAATG GGCGGCGCAT	Normal，1：181
	TAATACGACTCACTATAATG CGGCGCAT	No output
	TAATACGACTCACTATAAT CGGCGCAT	No output

④ Verification of A-tail sequence of mRNA.

step4： Software predicts the secondary structure of candidate sequences

Predict the secondary structure of candidate sequences to avoid sequences with stable or hyperstable complementary structures at the 5 'level.

EGFP mRNA
MFE：-314.62

saRNA-EGFP
MFE -2718.90

Step 1: Sequence Design

② UTR adaptability affects the expression effect of CDS sequences

Step 2: Plasmid preparation

1. Strain screening - controlling yield and super helix ratio

monoclonal

competence

2. Fermentation process - control OD600 and plasmid yield

Optimize various parameters for different receptive states and plasmids:

· Cultivation medium formula · Fermentation tank parameters · Feeding formula and feeding strategy · Fermentation tank control parameters

3. Important indicator for plasmid optimization - PolyA tail stability

Different receptive state transformation plasmids, selecting monoclonal antibodies with stable A tail

After fermentation amplification of different plasmid skeletons, the heterozygosity of PolyA tail in sequencing quality inspection varies

By screening the receptive/monoclonal/plasmid backbone and optimizing the fermentation process, we ultimately obtained plasmids with high helix ratios and stable PolyA tails

4. Purification process

(1) Optimization of Cracking Process

(2) Molecular sieve chromatography to remove RNA

(3) Affinity chromatography to remove open-loop plasmids

(4) Ion exchange chromatography to remove endotoxins

5. Product release testing

Quality control items	Number	Testing items	Test method
Bacterial seed bank inspection	1	Bacterial morphology	Microscopic observation
	2	Plasmid restriction enzyme digestion map	Restriction endonuclease digestion
	3	Target gene sequencing	Sequence
	4	Sequencing of other components	Sequence
	5	Bacterial identification	Cultivation method/bacterial staining/biochemical reaction
	6	Antibiotics resistance	Cultivation method
菌种传代稳定性	1	Plasmid sequence size	Electrophoresis/Sequencing
	2	Accuracy of plasmid sequence	Sequence
	3	Plasmid restriction enzyme digestion map	Restriction endonuclease digestion
	4	Plasmid copy number	ddPCR
	5	Passage restrictions	Cultivation method
Quality control of supercoiled plasmids	1	Appearance	Visual inspection method
	2	PH value	PH count
	3	Purity (A260/A280)	Ultraviolet spectrophotometer
	4	Identification of restriction endonucleases	Agarose gel
	5	Sequencing identification	Sequence
	6	Concentration	Spectrophotometry
	7	DNA homogeneity	Electrophoresis or HPLC
	8	Host protein DNA residue	Elisa
	9	RNA residue	Electrophoretic method
	10	Host DNA residue	QPCR
	11	Microbial limit/sterility	Membrane Filtration
	12	Endotoxin	TAL

WT-T7 (Customer System)

Yield: 191.9 μ g/20 μ L reaction

Integrity: 75.6%

Replace M6/optimize enzyme dosage

Yield: 176.8 μ g/20 μ L reaction

Integrity: 83.0%

Database analysis and buffer optimization

Yield: 240.1 μ g/20 μ L reaction

Integrity: 84.7%

Use enhancers (final IVT system)

Yield: 203.8 μ g/20 μ L reaction

Integrity: 88.2%

After final optimization, meet customer expectations

Step 3: In vitro transcription

Product release testing

Quality inspection items	Quality inspection method	Results Display
Concentration	Nanodrop method
Concentration	Ribogreen
Integrity	CE
Integrity	SEC-HPLC
DNA template residue	qPCR
Cap rat	LC-MS
Tail added distribution	LC-MS
Total protein residue	Nanoorange
Product related impurities - NTP residue	SEC-HPLC
Product related impurities - polymer quantification	SEC-HPLC
Product related impurities - residual T7 RNA polymerase content	ELISA
Endotoxin	Recombinant factor C/horseshoe crab reagent

Step 4: Translation proficiency testing

Verification level	Test method	Cycle	Results Display
Verification of intracellular expression levels	Fluorescence microscopy detection	3 days
	Flow analysis	3 days
	Detection of firefly luciferase	3 days
	Immunofluorescence IF	3 days
	WB	3 days
	ELISA	3 days
In vivo expression level validation	In vivo imaging	1-2 days
In vivo expression level validation	Serum protein expression detection	2 days

Step 5: LNP encapsulation

LNP microfluidic control preparation process

Prepare ethanolic lipid mixture with cationic lipid,phospholipid, sterol lipid,and PEGylated lipid

Prepare aqueous oligonucleotide solution

Mix using a range of specialized-to-basic equipment methods

Optional: Perform size extrusion

Uniformly sized lipid nanoparticles

Hanhai New Enzyme has explored and optimized the downstream purification process for LNP, mainly focusing on the development of inlet flow rate, Trans Membrane Pressure Drop (TMP), membrane pore size, membrane area, membrane material, hollow fibers, and flat plate membrane package. The process time can be controlled at around 3.5 hours, and the stability of mRNA LNP preparation at -80 ℃ can reach more than 18 months, and it can be frozen and thawed 10 times without affecting physical and chemical indicators

Long term stability of mRNA LNP preparation at -80 ℃

Freeze thaw stability of mRNA LNP formulations

Product release testing

Quality inspection items	Quality inspection method	Results Display
Entrapment efficiency	Ribogreen
Preparation RNA concentration	Ribogreen
PDI/particle size	DLS
Zeta potentials	Doppler electrophoresis
Molecular molar ratio of multivalent RNA molecules	ddPCR+qPCR
RNA sequence confirmation	Sanger sequencing/RT-PCR
Determination of lipid content	ELSD-HPLC
RNA integrity	CE/HPLC
Endotoxin	Recombinant factor C/horseshoe crab reagent
Protein expression validation	WB/FACS/IF/ELISA

Click here to jump

Service ordering and consultation

Website Link

Learn more

Templates preparation

About Us

News Center

Service ordering

Contact Us

Tel：400-808-5320
Email：hhxm-info@hzymes.com
Large scale production base: Building 6, Wuhan Precision Medical Industry Base, No. 9 Gaokeyuan Third Road, Wuhan City
Global Marketing Center: Hanhai Building, No. 3006 Huancheng West Road, Fengxian District, Shanghai

Customer service